【病毒外文文獻】2006 Preparation of His-Tagged Armored RNA Phage Particles as a Control for Real-Time Reverse Transcription-PCR Detectio

《【病毒外文文獻】2006 Preparation of His-Tagged Armored RNA Phage Particles as a Control for Real-Time Reverse Transcription-PCR Detectio》由會員分享，可在線閱讀，更多相關《【病毒外文文獻】2006 Preparation of His-Tagged Armored RNA Phage Particles as a Control for Real-Time Reverse Transcription-PCR Detectio（5頁珍藏版）》請在裝配圖網上搜索。

JOURNAL OF CLINICAL MICROBIOLOGY Oct 2006 p 3557 3561 Vol 44 No 10 0095 1137 06 08 00H110010 doi 10 1128 JCM 00713 06 Copyright 2006 American Society for Microbiology All Rights Reserved Preparation of His Tagged Armored RNA Phage Particles as a Control for Real Time Reverse Transcription PCR Detection of Severe Acute Respiratory Syndrome Coronavirus Yangjian Cheng 1 Jianjun Niu 2 Yongyou Zhang 1 Jianwei Huang 2 and Qingge Li 1 3 Key Laboratory of Cell Biology and Tumor Cell Engineering of the Ministration of Education Molecular Diagnostics Laboratory Department of Biomedical Sciences and School of Life Sciences Xiamen University 1 Xiamen Center for Disease Control and Prevention 2 and Key Laboratory of Chemical Biology of Fujian 3 Xiamen Fujian 361005 China Received 5 April 2006 Returned for modification 2 June 2006 Accepted 24 July 2006 Armored RNA has been increasingly used as both an external and internal positive control in nucleic acid based assays for RNA virus In order to facilitate armored RNA purification a His 6 tag was introduced into the loop region of the MS2 coat protein which allows the exposure of multiple His tags on the surface during armored RNA assembly The His tagged armored RNA particles were purified to homogeneity and verified to be free of DNA contamination in a single run of affinity chromatography A fragment of severe acute respiratory syndrome coronavirus SARS CoV genome targeted for SARS CoV detection was chosen for an external positive control preparation A plant specific gene sequence was chosen for a universal noncompetitive internal positive control preparation Both controls were purified by Co 2H11545 affinity chromatography and were included in a real time reverse transcription PCR assay for SARS CoV The noncompetitive internal positive control can be added to clinical samples before RNA extraction and enables the identification of potential inhibitive effects without interfering with target amplification The external control could be used for the quantification of viral loads in clinical samples External positive controls EPC and internal positive con trols IPC are important components in nucleic acid based testing An EPC is used to validate or calibrate the established assays while an IPC is employed to reveal potential inhibition 5 13 15 16 20 25 Ideally both controls should closely resemble the target of interest so as to track the entire process of the assay including pathogen lysis nucleic acid extraction RNA reverse transcription RT amplification and detection These controls should also be stable for long term storage and safe for routine use Currently used positive controls such as pure plasmids or naked RNA cannot fulfill these require ments In RT PCR particularly naked RNA fragments are too labile whereas plasmid DNA although more stable than RNA fragments is not representative of an authentic template in the RT procedure 6 Engineered phages are good alternatives for control prepa rations and have been successfully used to prepare nuclease resistant RNA positive controls armored RNA AR for RT PCR assays 4 17 18 24 as well as DNA positive controls lambda phage DNA for PCR assays 22 The advantages of phage controls include safety stability and physical character istics that mimic the natural virus Due to the extreme lability of RNA AR controls have been widely used 2 3 8 9 14 Unfortunately only a limited number of AR controls are com mercially available so far Most of the commercial ARs are of little assistance to researchers since they often use target se quences of their own which requires customer preparation of special AR The lack of safe and stable RNA controls could become a serious problem in cases of newly emerging patho gens such as severe acute respiratory syndrome coronavirus SARS CoV where cross infection could happen during sam ple exchange between laboratories 3 Therefore there is an urgent need for a simple and straightforward preparation method for AR of various species AR is an engineered MS2 phage assembly that encapsulates an RNA fragment of a target gene after expression in Esche richia coli Residual plasmid DNA contamination could seri ously compromise its quality and performance The major problem existing in the current AR preparation is its purifica tion procedure The current AR purification method involves the combined use of gradient ultracentrifugation and column chromatography 17 Despite that the procedure is expensive and labor intensive and has no quality control for DNA con tamination 17 In order to solve such problems we attempted to construct a recombinant plasmid for the expression of AR harboring an affinity tag at the surface of the MS2 phage assembly and we expected that AR could be purified in a single step of affinity chromatography Recently MS2 was pro posed as a scaffold for the display of short peptides on its surface 19 23 The coat protein gene was modified to enable the insertion of DNA at the central part of the H9252 hairpin loop Upon expression of the recombinant gene in E coli the MS2 coat protein subunits self assemble into capsids each compris ing 180 copies of the monomer coat protein We reasoned that a His 6 tag might also be displayed on the MS2 surface without affecting either the packing or the interaction at the protein RNA interface which would enable a simple rapid purifica tion by affinity chromatography AR expression was thus mod ified and was used to prepare one EPC and one IPC for Corresponding author Mailing address Department of Biomedi cal Sciences Xiamen University South Road of Siming 422 Xiamen 361005 China Phone 86 592 2182100 Fax 86 592 2187363 E mail qgli 3557 on March 23 2015 by MAHIDOL UNIV FAC OF MED http jcm asm org Downloaded from SARS CoV Both EPC and IPC could be easily purified by affinity chromatography proved to be of homogeneous purity and were successfully used in real time RT PCR detection of SARS CoV MATERIALS AND METHODS Preparation of His tagged AR The MS2 maturase and coat protein gene were obtained by RT PCR from MS2 RNA Roche Germany using the following primer pair 5H11032 CCTTTCGGGGTCCTGCTCAACTT 3H11032 and 5H11032 GATTAGATC TGAGTTGAACTTCTTTGTTGTCTTC 3H11032 the underlined sequence is a BglII restriction site The DNA fragment was then digested with restriction enzymes BglII and NcoI and ligated with linearized pSE380 Invitrogen Shanghai Peo ple s Republic of China to generate vector pAR 1 9 One region that covers all binding regions of the detection primers recommended by the WHO and the Chinese CDC in 2003 was selected for preparation of SARS CoV EPC The DNA fragment positions 15270 to 15628 gi 30271926 was obtained by RT PCR from SARS CoV RNA using primer pair 5H11032 GATTAGATCTCTAACAT GCTTAGGATAATGG 3H11032 positions 15250 to 15270 and 5H11032 GATTGGTACC AAATGTTTACGCAGGTAAGCGTAAAA 3H11032 positions 15603 to 15628 the underlined sequences are BglII and PstI restriction sites respectively through out this paragraph For the IPC preparation a 125 bp long plant specific ribu lose 1 5 bisphosphate carboxylase small subunit rbcs gene fragment was se lected and obtained by PCR from spinach DNA using primer pair 5H11032 GATTG GTACCCGGTCGTTACTGGACAATGTG 3H11032 and GATTGGTACCCGAATC CAATGATACGGATGAA 3H11032 Each DNA fragment described above was verified by direct DNA sequencing before digestion with BglII and PstI and insertion into linearized pAR 1 The His tag sequence was inserted into the above described vectors by intro ducing a KpnI restriction site between codons 15 and 16 of the coat protein using a site directed mutagenesis method 11 The synthesized His tag adaptor 5H11032 PO 4 GTACCCATCACCATCACCATCACG 3H11032 5H11032 PO 4 GTACCGTGATG GTGATGGTGATGG 3H11032 was annealed cleaved with KpnI and then ligated into the KpnI cleaved vectors After verification by DNA sequencing the newly generated recombinant plas mid was transformed into Escherichia coli strain DH5H9251 and protein expression was induced with 1 mM isopropyl L thio D galactopyranoside IPTG at 37 C for 16 h The production of AR was detected by nondenaturing agarose gel electro phoresis before purification Briefly after induction cells were collected by centrifugation and lysed by ultrasonic disruption After a brief centrifugation 10 000 H11003 g for 10 min the supernatant 20 H9262l was incubated with 2 U DNase I and or 100 U RNase A at 37 C for 4 h The product was checked by agarose gel electrophoresis 1 with the gel stained with ethidium bromide The intact AR was inspected by HITACHI Tokyo Japan H 600 trans mission electron microscopy TEM following negative staining with 1 phosphotungstic acid Purification of His tagged AR His tagged AR was purified with TALON metal affinity resin Clontech Laboratories Inc CA from bacterial lysates according to the manufacturer s instructions Briefly a total volume of 100 ml of induced bacterial culture was collected by centrifugation and then resuspended in cold lysis buffer 50 mM NaH 2 PO 4 300 mM NaCl 15 mM imidazole pH 8 0 After ultrasonic disruption to break cells and centrifugation to remove cell debris the supernatant was mixed with the resin preequilibrated with lysis buffer The resin was applied to the column after incubation for 30 min at 4 C The column was washed with washing buffer 50 mM NaH 2 PO 4 300 mM NaCl 30 mM imidazole pH 8 0 until the absorption of the eluent decreased to 0 01 or less The elution buffer 50 mM NaH 2 PO 4 300 mM NaCl 200 mM imidazole pH 8 0 was then applied to elute the His tagged AR The eluent was dialyzed against 10 mM Tris HCl pH 7 5 containing 100 mM NaCl and 1 mM EDTA for 12 h at room temperature with three buffer changes To monitor each step of the purification procedure different fractions were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE The purified AR was also analyzed by matrix assisted laser desorption ionization time of flight mass spectrometry MALDI TOF MS BiflexIII Bruker Daltonik GmbH Bremen Germany For comparison both tagged and untagged AR were also purified using su crose density gradient centrifugation After induction 100 ml of bacterial culture was collected by centrifugation and resuspended in 5 ml of lysis buffer 50 mM Tris HCl 5 mM MgSO 4 100 mM NaCl pH 8 0 Cells were lysed by ultrasonic disruption and the supernatant was stained with 1H11003 Gelstar Cambrex Inc for 20 min before it was applied to the centrifugation tubes where four sucrose density layers i e 15 25 35 and 45 were mixed Centrifugation was conducted at 160 000 H11003 g for4hat4 C The AR particle bands displaying green fluorescence were located at about 35 sucrose density when checked with a blue diode DNA gel illuminator Biovision Xiamen People s Republic of China The collected AR from the staining band was dialyzed as described above and was also subjected to MALDI TOF MS analysis The concentration of AR particles purified through affinity chromatography was determined using the extinction coefficient of 0 125 mg ml of MS2 bacterio phage per absorbance unit at 260 nm and a molecular weight of 3 0 H11003 10 6 9 AR purity test using real time PCR The purity of AR was checked by real time PCR amplification of the cloned region with and without the reverse transcription step Affinity purified AR was lysed by heating at 95 C for 5 min and was then added to each PCR mixture Each 30 H9262l RT PCR mixture con tained 5 H9262l lysed AR H1101110 6 copies ml 10 mM Tris HCl pH 8 6 50 mM KCl 1 0 U Taq 15 U Moloney murine leukemia virus reverse transcriptase 30 U RNasin 200 H9262M deoxynucleoside triphosphates 2 0 mM MgCl 2 0 4 H9262M each sense antisense primer and a molecular beacon probe For SARS CoV positive control detection the primer pair was 5H11032 GCTCGCAAACATAACACTTGC 3H11032 and 5H11032 ACATATAGTGAGCCGCCACACATG 3H11032 and the probe was 5H11032 6 car boxyfluorescein FAM CCGCACTACAGGTTAGCTAACGAGTGTGCGG Dabcyl 3H11032 The primer pair for the internal control was 5H11032 CTGTTGTTAGAC GACGAGG 3H11032 and 5H11032 GACTACAGACCACCAAATGC 3H11032 and the probe was 5H11032 6 carboxy 2H11032 4 4H11032 5H11032 7 7H11032 hexachlorofluorescein HEX CCCAGGCATTCTT CGAGCTCATTCAAAACCTGGG 3H11032 Dabcyl Real time detection was per formed using an iQ iCycler Bio Rad Hercules Calif started by RT for1hat 42 C if included followed by a denaturation step for 5 min at 95 C and 40 cycles of 15 s at 95 C 20 s at 56 C and 20 s at 72 C The fluorescent signal was acquired at the annealing step Real time RT PCR detection of SARS CoV A single step dual color real time RT PCR optimized for SARS CoV detection was carried out as follows Each 50 H9262l reaction mixture contained 10 mM Tris HCl pH 8 6 50 mM KCl 1 0 U Taq 15 U Moloney murine leukemia virus reverse transcriptase 20 U RNasin 200 H9262M deoxynucleoside triphosphates 3 0 mM MgCl 2 0 4 H9262M of each primer 0 4 H9262M probes primer and probe were the same as those described above 0 2 H9262M of each primer for internal control AR 0 2 H9262M of probe for internal control and 10 H9262l template RNA about 10 10 copies RT PCR was started by reverse transcription at 42 C for 30 min followed by 94 C for 5 min and 40 cycles of 30 s at 94 C and 30 s at 56 C The purified AR positive control was 10 fold serially diluted to create a calibration curve SARS CoV RNA from a variety of sources was extracted using RNA purifi cation kits BioVision Xiamen People s Republic of China Internal control AR 5 H9262l H1101110 4 copies this concentration was chosen due to its negligible influence on target amplification was added to specimens before RNA extrac tion Specimens include 17 confirmed patient samples 1 serum sample 15 bronchoalveolar lavage fluid samples and 1 stool sample and 20 SARS CoV containing cell culture samples All of the SARS CoV positive patient samples were confirmed for SARS CoV infection by an immunofluorescence assay and enzyme linked immunosorbent assay with a commercially available diagnostic kit Beijing Genomics Institute Beijing People s Republic of China In total 100 negative serum samples collected from healthy blood donors were also included and all these samples were confirmed to be negative by both immunofluores cence and enzyme linked immunosorbent assays FIG 1 Schematic illustration of the purification of His tagged AR with a Co 2H11001 affinity resin Each AR assembly has 180 units of coat protein and each coat protein has a His 6 tag exposed outward from the AR assembly allowing chelated Co 2H11001 on the resin beads accessibility to the His tag 3558 CHENG ET AL J CLIN MICROBIOL on March 23 2015 by MAHIDOL UNIV FAC OF MED http jcm asm org Downloaded from RESULTS Production of His tagged AR AR inserted with a His tag between amino acids 15 and 16 of the MS2 coat protein was expressed in E coli DH5H9251 and purified by a Co 2H11001 nitrilotri acetic acid column A schematic illustration of affinity purifi cation of His tagged AR is presented in Fig 1 Unlike a com mon terminal His tag the His insertion position in the AR was located at the central part of the H9252 hairpin loop of the coat protein that was exposed at the capsid surface and thus allowed the His tags accessibility to Co 2H11001 Like the MS2 bacteriophage one AR assembly is composed of 180 coat protein monomers Thus there would be a total of 180 His tags displayed on the outside surface of each AR particle The existence of the intact His tagged AR in the expression product was demonstrated by agarose gel electrophoresis which showed a single band of about 1 5 kb of DNA Fig 2A corresponding to the AR Treatment with DNase I or RNase A did not affect the AR band intensity while the bands for high molecular weight E coli genomic DNA and cellular RNA disappeared after digestion These results confirmed the pro duction and packaging of RNA into the viral protein shell and the protective effect of the coat protein on the encapsulated RNA A TEM photograph showed that the AR produced had the shape of a round particle that was 27 nm in diameter Fig 2B This was consistent with MS2 s icosahedral structure of the same size and further confirmed that the introduction of the His tag does not destroy the structure of the AR Purification of His tagged AR In order to keep the AR s integrity we used nondenaturing conditions to purify AR We tracked the purification procedure by using SDS PAGE which however showed the monomer of the coat protein in the denaturing environment As shown in Fig 3A the His tagged AR coat protein was captured by the resin lane 3 and was eluted as a single band lane 4 The molecular mass of the product shown was about 14 4 kDa which is consistent with 1 unit of the coat protein The exact molecular weight of the His tagged coat protein was then measured with MALDI TOF MS The measured value of 14 739 15 Fig 3B was consistent with the theoretical molecular weight of 14 739 89 calculated from the weights of the original coat protein 13 729 12 plus His 6 155 09 one glycine 119 18 and one threonine 750 5 subtracted by that of 8H11003 H 2 O In comparison the untagged coat protein purified by sucrose density gradient centrifugation showed a molecular weight of 13 728 87 Fig 3C which is very close to its theoretical value of 13 729 12 as well The purity of affinity purified AR Following affinity chro matography the quantity of AR was measured through ab sorption measurements Usually 1 0 mg of pure AR could be obtained with 2 ml fresh resin from 100 ml of cell culture The RNA copy number was estimated through absorption mea surements To check whether there are any DNA contami nants in the AR preparation after affinity purification both PCR and RT PCR were performed If there is any residual plasmid DNA contamination both PCR and RT PCR will produce an amplicon otherwise only RT PCR will produce an amplicon Our results showed that all affinity purified AR con trols produced robust RT PCR signals but negligible PCR signals even in the presence of large amounts of AR Fig 4C In contrast unpurified AR Fig 4A or AR purified by sucrose density gradient centrifugation Fig 4B gave significant am plification signals with both RT PCR and PCR procedures indicating the existence of a large amount of plasmid DNA FIG 2 Intact His tagged AR assembly expressed in E coli A Agarose gel electrophoresis of AR treated H11001 and not treated H11002 with DNase I and or RNase A B TEM photograph of the His tagged AR FIG 3 Purification of the His tagged AR and its molecular weight A Different fractions of the affinity chromatography were run on an SDS PAGE gel and stained with Coomassie brilliant blue R 250 Lane 1 supernatant of the cells lysate lane 2 flowthrough solution lane 3 first wash solution lane 4 eluted solution lane 5 marker B MALDI TOF MS of His tagged and untagged coat protein Affinity purified AR was denatured by treatment with 10 H9252 mercaptoethanol at 95 C for 1 min The precipitated protein was dissolved in 10 H9262l of 0 1 trifluoroacetic acid and purified with a Ziptip C 18 column Millipore Shanghai People s Republic of China The eluted protein solution 1 H9262l was mixed with matrix solution and then subjected to MALDI TOF MS analysis VOL 44 2006 HIS TAGGED ARMORED RNA CONTROLS FOR SARS CoV DETECTION 3559 on March 23 2015 by MAHIDOL UNIV FAC OF MED http jcm asm org Downloaded from The above described results were confirmed by using many different preparations Real time RT PCR detection of SARS CoV According to the guidelines recommended by the WHO we included both EPC and IPC for single tube dual color real time RT PCR detection of SARS CoV The AR EPC was used to establish a calibration curve for SARS CoV quantification as well as for the evaluation of the overall performance of the assay An IPC was included in the reaction mixture to monitor whether any potential inhibition occurred in the assay procedures From the calibration curve the limit of detection was determined to be 5 copies per assay The calibration curve established with EPC concentration again