【病毒外文文獻】2005 Novel Immunofluorescence Assay Using Recombinant Nucleocapsid-Spike Fusion Protein as Antigen To Detect Antibodies

《【病毒外文文獻】2005 Novel Immunofluorescence Assay Using Recombinant Nucleocapsid-Spike Fusion Protein as Antigen To Detect Antibodies》由會員分享，可在線閱讀，更多相關《【病毒外文文獻】2005 Novel Immunofluorescence Assay Using Recombinant Nucleocapsid-Spike Fusion Protein as Antigen To Detect Antibodies（8頁珍藏版）》請在裝配圖網上搜索。

CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY Feb 2005 p 321 328 Vol 12 No 2 1071 412X 05 08 00H110010 doi 10 1128 CDLI 12 2 321 328 2005 Copyright 2005 American Society for Microbiology All Rights Reserved Novel Immunofluorescence Assay Using Recombinant Nucleocapsid Spike Fusion Protein as Antigen To Detect Antibodies against Severe Acute Respiratory Syndrome Coronavirus Qigai He 1 Ivanus Manopo 1 Liqun Lu 1 Bernard P Leung 2 Hiok Hee Chng 2 Ai Ee Ling 3 Li Lian Chee 1 Shzu Wei Chan 1 Eng Eong Ooi 4 Yeo Lee Sin 5 Brenda Ang 5 and Jimmy Kwang 1 Animal Health Biotechnology Temasek Life Science Laboratory National University of Singapore 1 Department of Rheumatology Allergy L Lu I Manopo B P Leung H H Chng A E Ling L L Chee E E Ooi S W Chan and J Kwang J Clin Microbiol 42 1570 1576 2004 In the present study the N195 Sc fusion protein was highly expressed in insect Sf9 cells infected with a recombinant baculovirus bearing the hybrid gene under the control of a polyhedrin promoter An IFA based on Sf9 cells producing the fusion protein was standardized with 23 serum samples from patients with SARS 20 serum samples from patients with autoim mune diseases and 43 serum samples from healthy blood donors The detection rates were comparable to those obtained with a commercial SARS CoV IFA kit EUROIMMUN Gross Groenau Germany and a conventional IFA performed at the Singapore General Hospital Our data showed that the newly developed IFA could detect SARS CoV in 22 of the 23 SARS CoV positive serum samples and gave no false positive results when the sera from patients with autoimmune diseases and healthy individuals were tested The detection rate was identical to those of the two whole virus based IFAs Thus the novel N S fusion antigen based IFA could be an attractive alternative to present whole virus based IFAs for the diagnosis of SARS CoV infection In February 2003 a physician from Guangdong Province People s Republic of China fell ill while staying in a hotel in Hong Kong Later the respiratory illness spread to 12 other hotel guests who subsequently traveled to their own countries starting a worldwide epidemic This disease has come to be known as severe acute respiratory syndrome SARS which is caused by a coronavirus called SARS associated coronavirus SARS CoV Scientists around the world responded quickly to the SARS outbreak by isolating the novel virus and devel oping rapid diagnostic methods for the early detection of SARS CoV infection 1 2 4 The methods currently available for the detection of SARS CoV are i virus isolation by inoculation of the patient bio logical samples into cell cultures such as Vero cell cultures ii nucleotide sequence detection by PCR or reverse transcrip tion PCR RT PCR in which stringent laboratory procedures need to be adhered to to avoid cross contamination of the samples 7 11 iii antigen detection with specific monoclonal antibodies to the SARS CoV antigen and iv antibody detec tion with viral protein and virus infected cells by enzyme linked immunosorbent assay ELISA and immunofluores cence assay IFA respectively However because of its high degree of pathogenicity and infectivity for humans antigen production for ELISA and IFA requires a biosafety level 3 BSL 3 research facility as its production involves the use of live SARS CoV 12 This restriction makes it difficult to pre pare diagnostic reagents In our previous work 3 5 we have identified the major immunodominant fragments of both the nucleocapsid N195 and the spike Sc proteins of SARS CoV The recombinant protein based Western blot assay showed a high antibody de tection rate 3 5 However this method is labor intensive and time consuming as the methods involved protein expression and purification At present IFA is regarded as the gold standard for the detection of SARS CoV infection However Corresponding author Mailing address Animal Health Biotech nology Temasek Life Science Laboratory 1 Research Link National University of Singapore Singapore 117604 Phone 65 68727473 Fax 65 68727007 E mail kwang tll org sg 321 on May 23 2015 by guest http cvi asm org Downloaded from it involves the hazardous work of virus cultivation in a BSL 3 laboratory To explore a sensitive assay which does not involve the manipulation of live SARS CoV we developed an IFA using the Spodoptera frugiperda insect cell line Sf9 and a re combinant baculovirus to express the N195 Sc fusion protein as the antigen for the detection of antibodies against SARS CoV In this fusion protein based IFA technique no cross reaction with other coronavirus infected sera was found The specificity and sensitivity of our novel IFA were assessed with a panel of serum samples comprising 23 serum samples posi tive for SARS CoV 20 serum samples from patients with au toimmune diseases and 43 serum samples from healthy indi viduals The results were compared to those obtained by two other whole virus based IFAs a commercial SARS CoV IFA kit EUROIMMUN Gross Groenau Germany and the con ventional IFA performed in a BSL 3 laboratory at the Singa pore General Hospital as well as our N195 based Western blotting assay MATERIALS AND METHODS Serum samples Sera were collected from 23 patients 4 to 49 days after the onset of symptoms satisfying the World Health Organization definition of SARS Twenty serum samples from patients with autoimmune diseases and 43 serum samples from healthy individuals were obtained from Singapore General Hos pital and Tan Tock Seng Hospital The serum samples were heat inactivated at 60 C for 1 h before use Four serum samples from infectious bronchitis virus infected chickens 4 se rum samples from transmissible gastroenteritis virus infected swine and 12 ca nine coronavirus vaccinated serum samples from dogs were used to test for cross reactivity Ten serum samples from stray dogs and 10 serum samples from stray cats were also tested Production of polyclonal antibodies against N protein and spike protein The N195 and Sc proteins were expressed and purified as described in our previous reports 3 5 The guinea pigs were immunized with purified N195 or Sc proteins at a concentration of 100 H9262g each Booster injections were administered at 2 week intervals Ten days later the animals were euthanized for serum prepa ration The samples were evaluated for antibodies against the N195 and Sc proteins by N195 and Sc protein based ELISAs respectively and with a com mercial SARS CoV IFA kit with inactivated whole SARS CoV infected Vero cells The patterns of reactivity of these antisera with protein were observed The two antisera were used to monitor N195 and Sc protein expression in Sf9 cells infected with the recombinant virus containing the fusion protein by Western blotting and N195 Sc fusion protein based IFA as described below Construction of nucleocapsid and spike protein expression vector Viral RNA was extracted from inactivated virus culture supernatant by using Trizol reagents Gibco Grand Island N Y and was reverse transcribed to produce cDNA The cDNA was used as the template for PCR amplification to yield truncated N195 and Sc gene fragments by using the primer pairs listed in Table 1 The amplified N195 and Sc DNA fragments were digested and ligated at their respective sites to form an N195 Sc fusion gene fragment followed by subcloning into the BamHI KpnI site of pFASTBacHT and transformation into Escherichia coli DH5H9251 competent cells The presence of the resultant recombinant transfer plasmids pFASTBac N195 and pFASTBac N195 Sc were verified by PCR with the primers in Table 1 and sequence analysis was done Recombinant plasmid DNAs were prepared with Wizard mini prep kit Promega Homologous re combination was carried out by transposition of plasmid DNA into DH10B competent cells inoculation of the cells onto Luria agar containing 5 bromo 4 chloro 3 indolyl H9252 D galactopyranoside and isopropyl H9252 D thiogalactopyrano side and cultivation at 37 C The white colonies were selected and inoculated into Luria Bertani medium supplemented with 50 H9262g of kanamycin per ml 7 H9262g of gentamicin per ml and 10 H9262g of tetracycline per ml and were grown at 37 C with shaking at 250 to 300 rpm The isolation of recombinant bacmids was performed in the Bac to Bac baculovirus expression system Invitrogen Carls bad Calif according to the instructions of the manufacturer and these bacmids were identified by PCR with the pUC M13 primer pair Transfection and protein expression analyses Sf9 cells were transfected with the recombinant bacmids by using a Lipofectinmine kit Invitrogen according to the instructions in the manual provided by the manufacturer At 72 h post transfection the cell pellets were assayed for protein expression by a Western blotting assay in which guinea pig antinucleocapsid antispike monospecific se rum and human SARS CoV positive serum were used as the primary antibodies Horseradish peroxidase HRP conjugated goat anti guinea pig anti mouse im munoglobulin Ig and anti human IgG were used as secondary antibodies The membrane was developed by using 3 3H11032 diaminobenzidine tetrahydrochloride Pierce Rockford Ill as the substrate Protein expression was also assessed by a newly developed IFA as described below That assay uses the same primary antibodies used in the Western blotting assay and fluorescein isothiocyanate FITC conjugated antibodies as the sec ondary antibodies Examination for fluorescent staining was performed under a fluorescence microscope Identification and titration of the recombinant baculovirus Viral DNA was extracted from the viral pellet by phenol chloroform isoamyl alcohol extraction 6 The viral pellet was prepared from the virus containing supernatant by centrifugation at 20 000 H11003 g for 2 h Viral DNA was used as the template for the identification of recombinant baculovirus by PCR with the pUC and M13 am plification primers The cycling conditions were 3 min at 94 C followed by 35 cycles of 45 s at 94 C 45 s at 55 C and 5 min at 72 C and a 10 min hold at 72 C The amplified product was eletrophoresed on 1 agarose Determination of recombinant baculovirus titer was accomplished by a viral plaque assay Briefly 2 ml of Sf9 cells grown to 5 H11003 10 5 cells ml were dispensed into each well of a six well plate The plate was incubated at room temperature for1htoensure cell attachment The harvested viral supernatant was diluted in eight series of 10 fold dilutions for inoculation After the supernatant was re moved from each well the Sf9 cells were inoculated with the diluted viral supernatant and the mixture was incubated for1hat27 C Then the virus inoculum was aspirated from the well and replaced with 2 ml of the baculovirus agarose The plate was incubated at 27 C in a humidified incubator for 4 to 10 days The gray plaques were counted and the titer was calculated by the follow ing formula PFU of original stock H11005 1 dilution factor H11003 number of plaques H11003 1 milliliter of inoculum well Time course study of fusion protein expression by Western blotting and IFA To determine the time when the level of protein expression reached a peak to provide a clue as to the optimal time for immunofluorescence antigen prepara tion Sf9 cells in 6 and 96 well plates were simultaneously infected with the TABLE 1 Primer pairs used for PCR amplification of N195 Sc and N195 Sc fusion protein fragments Gene amplified Primer direction Primer sequence Size bp Truncated N195 protein Forward 5H11032 CGGGATCCAACCAGCTTGAGAGCAAAGTTTC 3H11032 a 585 Reverse 5H11032 GGGGTACCTGCCTGAGTTGAATCAGCTCC 3H11032 a N195 Sc fusion protein 1 425 N195 Forward 5H11032 CGGGATCCAACCAGCTTGAGAGCAAAGTTTC 3H11032 a Reverse 5H11032 ACGCGTCGACTGCC TGAGTTGAATCAGCTCC 3H11032 a Sc Forward 5H11032 ACGCGTCGACGATTACTCTGTGCTCTACAAC 3H11032 b Reverse 5H11032 GGGGTACCCTGGAATACAT TGTTTCCAGT 3H11032 b a The BamHI and KpnI sites are underlined b The BamHI SalI and KpnI sites are underlined 322 HE ET AL CLIN DIAGN LAB IMMUNOL on May 23 2015 by guest http cvi asm org Downloaded from recombinant baculovirus at a multiplicity of infection of 5 PFU cell The plates were incubated at 27 C in a humidified incubator At 12 h intervals postinfection i e at 12 24 36 48 60 and 72 h postinfection the infected Sf9 cells were analyzed by Western blotting and IFA In the Western blotting assay and IFA the primary antibodies were guinea pig anti N195 or anti Sc serum monoclonal antibody against the six His tag and human SARS CoV positive serum HRP or FITC conjugated antibodies were used as secondary antibodies Noninfected cells were used as a negative control Development of the novel IFA At 36 h after infection Sf9 cells which ex pressed the fusion protein at peak levels were selected for the development of the novel IFA The cells in 96 well plates were fixed with absolute ethanol for 30 min at room temperature and were washed three times with phosphate buffered saline PBS pH 7 4 The fixed cells were incubated with anti N195 and anti Sc serum from guinea pig serum and SARS CoV positive human serum respec tively at 37 C for 1 h After the wells were washed three times the antigens were reacted with FITC conjugated anti guinea pig Ig 1 40 Dako Glostrup Den mark and FITC conjugated rabbit anti human IgG and IgM 1 40 Dako as appropriate After another three washes with PBS the Sf9 cells were examined for the staining pattern under an immunofluorescence microscope Olympus Tokyo Japan with appropriate barrier and excitation filters for optimized visu alization of the FITC For IFA optimization SARS CoV positive human serum and SARS CoV negative serum were serially diluted 1 5 1 10 1 25 1 50 1 100 1 200 and 1 500 and the secondary antibodies FITC conjugated rabbit anti human IgG and IgM were diluted 1 20 1 30 1 40 1 80 and 1 160 IFA was performed as described above for IgG and IgM detection The optimal condition was defined to be a reaction in which the maximum fluorescent signals were observed with no back ground reading Commercial SARS CoV IFA kit A commercial SARS CoV IFA kit EURO IMMUN was purchased from Medizinische Labordiagnostika AG Gross Groe nau Germany The kit is composed of biochip slides coated with SARS CoV infected cells which had been treated with a disinfecting fixing agent and gamma irradiation The test was conducted according to the instructions of the manu facturer Briefly the serum sample was diluted 1 10 in the sample buffer provided FIG 1 Recognition of guinea pig polyclonal antibodies against truncated N195 Sc protein with native nucleocapsid protein a or spike protein b in SARS CoV infected Vero cells The SARS CoV positive human serum sample c served as a positive control Each antiserum sample with SARS CoV infected Vero cells a to c and mock infected cells g to i was examined under a fluorescence microscope for its reactivity pattern In order to show clearly that the antisera reacted only with infected cells and not with adjacent uninfected cells side by side images of the same field were viewed under a light microscope d to f and an immunofluorescence microscope a to c VOL 12 2005 IFA FOR DETECTION OF SARS CORONAVIRUS 323 on May 23 2015 by guest http cvi asm org Downloaded from with the kit and the contents were mixed by vortexing for 4 s Twenty five microliters of the diluted serum sample was applied to each reaction field in the reagent tray The biochip slide which contained chips of inactivated SARS CoV infected Vero cells alongside uninfected cells was then placed on the recesses of the reaction tray where the biochips and the serum samples were allowed to interact for 30 min at room temperature The biochip slide was rinsed with PBS Tween 20 for at least 5 min and 20 H9262l of fluorescein labeled anti human globulin was applied to the reaction chip for 30 min at room temperature The slide was rinsed again Glycerol was added to the coverslip and the slide was placed facing forward onto the prepared coverslip The slide was viewed under an inverted fluorescence microscope Olympus Conventional IFA The conventional IFA was carried out in a BSL 3 labora tory as described in our previous work 3 SARS CoV was propagated in Vero E6 cells at 37 C until cytopathic effects were seen in 75 of the cell monolayer after which the cells were harvested spotted onto Teflon coated slides and fixed with 80 cold acetone Uninfected Vero E6 cells were used as controls in this experiment Serum samples were tested at a 1 10 dilution and were washed with 1H11003 PBS after they had been incubated either for 90 min followed by the addition of FITC conjugated rabbit anti human IgM or for 30 min followed by the addition of FITC conjugated anti human IgG The slides were then incubated for another 60 min at 37 C The slides were subjected to another washing cycle before they were read for specific fluorescence under an immunofluorescence microscope Western blotting Purified truncated N195 protein was immunoblotted onto a nitrocellulose membrane pore size 0 45 H9262m Bio Rad All serum samples were screened at a dilution of 1 100 followed by the addition of peroxidase conju gated secondary antibody Dako according to the instructions of the manufac turer 3 3H11032 Diaminobenzidine tetrahydrochloride Pierce was used as the HRP substrate for membrane development Positive and negative controls were in cluded in each test A sample was considered positive if a specific band of the expected size was observed Calculations Analysis of the performance of our novel IFA was based on comparison of the data obtained by our novel IFA to those obtained by the commercial IFA the conventional IFA and Western blotting as established in our previous work 3 The sensitivity and specificity of the assays were calculated by using the following equations sensitivity H11005 number of samples with true positive results number of samples with true positive results H11001 number of sam ples with false negative results and specificity H11005 number of samples with true negative results number of samples with true negative results H11001 number of samples with false positive results RESULTS Reactivities of polyclonal antibodies with recombinant and native proteins The ELISA verified that polyclonal antibodies against the N195 and Sc proteins were raised in guinea pigs The titers were 1 4 000 for the antibody against N195 and 1 1 000 for the antibody against Sc Furthermore both anti bodies also recognized the authentic N and spike proteins in assays with the commercial SARS CoV IFA kit in which SARS CoV infected Vero cells were inactivated and served as the fluorescence antigen The fluorescence was found to be cytoplasmic when antiserum against both the N195 and the Sc proteins were used as the primary antibody Fig 1a and b The antisera were shown to react only with infected cells and not with adjacent uninfected cells by comparing the same field under a light microscope Fig 1d and e and a fluorescence microscope Fig 1a and b while no nonspecific fluorescence was observed in mock infected cells Fig 1g and h The IFA titers were 1 40 and 1 10 for antibodies against the N195 and Sc proteins respectively with the commercial SARS CoV IFA kit Identical reactivity patterns were found between two poly clonal antisera and human SARS CoV positive serum Fig 1c f and i Table 2 These data demonstrate that both polyclonal antibodies can be used as standard positive sera for protein identification in the process of development of our novel IFA Construction of recombinant baculovirus The N195 or Sc gene fragment was amplified by RT PCR followed by ligation with a Rapid ligation kit Roche Mannheim Germany and transformation into DH5H9251 cells The positive colonies that harbored the N195 or the N195 Sc fusion gene fragment were screened followed by extraction of recombinant plasmids and transposition with DH10Bac competent cells We selected a few white colonies on the Luria Bertani plate containing 5 bro mo 4 chloro 3 indolyl H9252 D galactopyranoside and isopropyl H9252 D thiogalactopyrano