【病毒外文文獻】2004 Induction of IL-8 Release in Lung Cells via Activator Protein-1 by Recombinant Baculovirus Displaying Severe Acute

《【病毒外文文獻】2004 Induction of IL-8 Release in Lung Cells via Activator Protein-1 by Recombinant Baculovirus Displaying Severe Acute》由會員分享，可在線閱讀，更多相關《【病毒外文文獻】2004 Induction of IL-8 Release in Lung Cells via Activator Protein-1 by Recombinant Baculovirus Displaying Severe Acute（14頁珍藏版）》請在裝配圖網上搜索。

of March 4 2015 This information is current as Regions Proteins Identification of Two Functional Respiratory Syndrome Coronavirus Spike Baculovirus Displaying Severe Acute Activator Protein 1 by Recombinant Induction of IL 8 Release in Lung Cells via Yu Chan Chao and Ching Chow Chen Ya Jen Chang Catherine Y Y Liu Bor Luen Chiang http www jimmunol org content 173 12 7602 doi 10 4049 jimmunol 173 12 7602 2004 173 7602 7614 J Immunol References http www jimmunol org content 173 12 7602 full ref list 1 25 of which you can access for free at cites 47 articlesThis article Subscriptions http jimmunol org subscriptions is online at The Journal of ImmunologyInformation about subscribing to Permissions http www aai org ji copyright html Submit copyright permission requests at Email Alerts http jimmunol org cgi alerts etoc Receive free email alerts when new articles cite this article Sign up at Print ISSN 0022 1767 Online ISSN 1550 6606 Immunologists All rights reserved Copyright 2004 by The American Association of 9650 Rockville Pike Bethesda MD 20814 3994 The American Association of Immunologists Inc is published twice each month byThe Journal of Immunology at Georgian Court Univ on March 4 2015 http www jimmunol org Downloaded from at Georgian Court Univ on March 4 2015 http www jimmunol org Downloaded from Induction of IL 8 Release in Lung Cells via Activator Protein 1 by Recombinant Baculovirus Displaying Severe Acute Respiratory Syndrome Coronavirus Spike Proteins Identification of Two Functional Regions 1 Ya Jen Chang 2 Catherine Y Y Liu 2 Bor Luen Chiang Yu Chan Chao 2 3 and Ching Chow Chen 3 The inflammatory response and the intracellular signaling pathway induced by severe acute respiratory syndrome SARS coronavirus CoV were studied in lung epithelial cells and fibroblasts SARS CoV spike S protein encoding plasmid induced activations of IL 8 promoter and AP 1 but not NF H9260B in these cells Mutation of the AP 1 not the H9260B site abolished the SARS CoV S protein induced IL 8 promoter activity IL 8 release was effectively induced by vAtEpGS688 a baculovirus exhib iting the aa 17 688 fragment of S protein and this induction was attenuated by the angiotensin converting enzyme 2 Ab Re combinant baculovirus expressing different deletion and insertion fragments identified the functional region of S protein from aa 324 688 particularly the N terminal aa 324 488 and the C terminal aa 609 688 which is responsible for IL 8 production Activations of AP 1 DNA protein binding and MAPKs after vAtEpGS688 transduction were demonstrated and SARS CoV S protein induced IL 8 promoter activity was inhibited by the specific inhibitors of MAPK cascades These results suggested that the S protein of SARS CoV could induce release of IL 8 in the lung cells via activations of MAPKs and AP 1 The identification of the functional domain for IL 8 release will provide for the drug design on targeting specific sequence domains of S protein responsible for initiating the inflammatory response The Journal of Immunology 2004 173 7602 7614 C oronaviruses CoV 4 are a family of enveloped viruses with positive stranded capped and polyadenylated RNA genomes ranging in size from 28 to 32 kb 1 Two thirds of the viral genome starting from the 5H11032 end encode replicase pro teins Rep1a and Rep1b for the amplification of CoV RNA Struc tural proteins including spike S envelope E membrane M nucleocapsid N and several others with unknown functions are also expressed in the CoV 1 In March 2003 a new member of CoV the severe acute respiratory syndrome SARS CoV was discovered as the causative agent of SARS 2 5 Ultimately the virus infected H110228000 people and killed H11022700 mostly in Asia SARS CoV does not belong to any of the previously defined ge netic and serological CoV groups SARS CoV S protein is essen tial for the process of viral infection and SARS CoV N protein is important for the transcription of viral RNA Both proteins can serve as targets for the early diagnosis of infection The S proteins of CoV are major targets for neutralizing Abs and form the characteristic corona of large and distinctive spikes on the viral envelopes 1 6 Similar 20H1101140 nm complex surface projections constituted of S proteins also surround the SARS CoV particles 2 The amino acid sequence homology between SARS CoV S protein and other CoV is low 20 27 identity except for some conserved regions in the S2 domain 3 The S1 domain of all characterized CoV including SARS CoV mediates the initial high affinity interaction with the cellular receptor 7 9 Receptor identification is important for the understanding of vi ral tropism pathogenicity and mechanism of entry which may help in the development of therapeutics and vaccines The angio tensin converting enzyme 2 ACE2 has been identified as the re ceptor on Vero E6 and 293T cells 10 for SARS CoV The re ceptor binding domain RBD of SARS CoV S protein was first characterized to be located in the N terminal NT region of 318H11011510 aa 11 Afterward two other groups identified the RBD to be situated between 303H11011537 and 270H11011510 aa of the NT re gion respectively 12 13 which were approximately the same region suggested by the first group Although the entrance of SARS CoV into the host cell has been demonstrated to be through the binding of S protein to ACE2 the immune response induced by SARS CoV remains undercharacterized High serum levels of IL 8 and IL 6 in the acute stage cytokine storm associated with lung lesions were found in SARS patients 14 The elevations of the plasma chemokine IL 8 and Th1 related cytokine can induce the hyperinnate inflammatory response due to the SARS CoV invasion of the respiratory tract Corticosteroid can suppress the elevated IL 8 and subsequently alleviate the chemo kine associated pulmonary inflammation in SARS 15 In the present study SARS CoV S protein induced IL 8 release in lung Departments of Pharmacology and Pediatrics College of Medicine National Tai wan University and National Taiwan University Hospital Taipei Taiwan and In stitute of Molecular Biology Academia Sinica Nankang Taipei Taiwan Received for publication July 20 2004 Accepted for publication October 14 2004 The costs of publication of this article were defrayed in part by the payment of page charges This article must therefore be hereby marked advertisement in accordance with 18 U S C Section 1734 solely to indicate this fact 1 This work was supported by research grants from the National Science Council of Taiwan for SARS NSC 92 2751 B002 010Y NSC93 2751 B002 005Y 2 Y J C C Y Y L and Y C C contributed equally to this study 3 Address correspondence and reprint requests to Dr Ching Chow Chen Department of Pharmacology College of Medicine National Taiwan University No 1 Jen Ai Road 1st Section Taipei 10018 Taiwan or Dr Yu Chan Chao Institute of Molec ular Biology Academia Sinica Nankang Taipei 115 Taiwan E mail address ccchen ha mc ntu edu tw or mbycchao imb sinica edu tw 4 Abbreviations used in this paper CoV coronavirus ACE angiotensin converting enzyme AcMNPV Autographa californica nucleopolyhedrovirus CT C terminal DN dominant negative E envelope EGFP enhanced GFP M membrane MKK MAPK kinase MOI multiplicity of infection N nucleocapsid NT N terminal RBD receptor binding domain S spike SARS severe acute respiratory syndrome SP signal peptide wt wild type The Journal of Immunology Copyright 2004 by The American Association of Immunologists Inc 0022 1767 04 02 00 at Georgian Court Univ on March 4 2015 http www jimmunol org Downloaded from epithelial cells A549 and NCI H520 and lung fibroblasts HFL 1 and MRC 5 and the transcription factor involved are studied Effects of transient transfections of the SARS CoV S protein en coding plasmid on the IL 8 promoter AP 1 and NF H9260B were ex amined A recombinant baculovirus containing 688 aa length of SARS CoV S protein vAtEpGS688 which could transduce the lung cells via expressing the S protein on its surface was used as a tool for measuring IL 8 release Our results showed that SARS CoV S protein induced AP 1 activation and up regulated IL 8 re lease A functional region of the S protein aa 324 688 was iden tified as being essential for the induction of IL 8 release The intracellular signaling pathway was closely examined and it was found that MAPKs and AP 1 but not NF H9260B were activated Materials and Methods Reagents and plasmids Phosphospecific Abs to ERK p38 and JNK and T4 polynucleotide kinase were purchased from New England Biolabs Beverly MA Abs specific to ERK p38 and JNK were from Santa Cruz Biotechnology Santa Cruz CA and Ab specific to ACE2 was from Alpha Diagnostic International San Antonio TX RPMI 1640 FCS penicillin and streptomycin were from Invitrogen Life Technologies Gaithersburg MD PD98059 SB203580 and SP600125 were from Calbiochem San Diego CA Re agents for SDS PAGE were from Bio Rad Hercules CA Poly dI dC was from Amersham Biosciences Piscataway NJ H9253 32 P ATP 3000 Ci mmol was from PerkinElmer Life and Analytical Sciences Boston MA the SuperFect reagent was from Qiagen Valencia CA and the luciferase assay kit was from Promega Madison WI The full length cDNA of the S protein of SARS CoV TW1 clone characterized by the National Tai wan University SARS Research Team 16 was subcloned into the pcDNA3 1 The AP 1 and NF H9260B luciferase reporters were from Strat agene La Jolla CA The IL 8 promoter construct IL 8 wild type wt H11002162 H1100144 AP 1 site mutation IL 8H9004AP 1 and H9260B site mutation IL 8H9004H9260B were gifts from A Brasier University of Texas Medical Brach Galveston TX The dominant negative DN mutant of ERK2 was from M Cobb South Western Medical Center Dallas TX p38 T180A T182F was from J Han Scripps Research Institute San Diego CA and JNK T183A Y185F was from M Karin University of California San Diego CA pSVfos was a gift from W Chang National Cheng Kung University Tainan Taiwan Transient transfection and luciferase activity assay Cells grown to 60 confluence in 12 well plates were transfected with either the human IL 8 wt AP 1 luc or NF H9260B luc using SuperFect Qia gen according to the manufacturer s recommendations and our previous description 17 In experiments using DN mutants cells were cotransfected with reporter 0 3 H9262g and H9252 galactosidase 0 15 H9262g 0 45 H9262g of the pcDNA3 1 S or the empty vector and either the DN ERK p38 and JNK mutants or the empty vector 0 6 H9262g Construction of recombinant baculoviruses The coding sequence of enhanced GFP EGFP with a poly A termination signal was inserted into the pTriEx 3 Novagen Madison WI transfer vector at the NcoI and HindIII sites The resulting pAtE plasmid contained the EGFP gene under the control of both p10 and cmv promoters and expressed egfp in both insect and mammalian cells The signal peptide SP of Autographa californica nucleopolyhedrovirus AcMNPV gp64 gene was amplified from purified wt AcMNPV genomic DNA using oligonu cleotide primers GPSF and GPSR2 for all primer sequences see Table I The NT of gp64 gene was amplified using GPSF and GPNT227R The CT of gp64 gene was amplified using GPCF227 and GPCR The SP NT and CT fragments were cloned into the PstI KpnI and KpnI SmaI sites of the pBacPAK8 transfer vector BD Clontech Palo Alto CA under the control of a polyhedrin promoter The polyhedrin promoter plus the partial gp64 gene and the poly A termination signal were cleaved out using the EcoRV and HindIII restriction sites and ligated into the PvuII and HindIII sites on the pAtE plasmid creating the pAtEpG pAtEpGf f H11005 full length gp64 plasmids The various CT truncations of the SARS CoV spike gene minus the signal sequence were obtained by PCR from a full length TW1 spike clone kindly provided by P J Chen of National Taiwan University Six PCR fragments coding for spike gene fragments S280 S324 S488 S688 S763 and S966 were amplified see Fig 2B and used to make the spike CT deletion expression vectors The number here represents the most CT amino acid residue of the particular Spike fragment The SpikeF2 primer was the universal 5H11032 primer The reverse primers SpikeRX in which X corresponded to a Spike amino acid residue number are shown in Table I All six PCR products were first cloned into pZeroBlunt Invitrogen Life Technologies then cut with SfiI restriction enzyme and inserted into SfiI cut pAtEpG vector resulting in pAtEpGSX in which X represents the most CT spike amino acid residue e g pAtEpGS280 To construct the spike insertion vectors three internal fragments of the spike gene S489 534 S489 609 and S489 688 were amplified using SpikeF489 and SpikeRX X H11005 534 609 or 688 These fragments were inserted into the SfiI site of the pAtEpGf vector resulting in pAtEpGS489 534 pAtEpGS489 609 and pAtEpGS489 688 All these spike expressing plasmids plus the pAtE control plasmid were cotransfected with vAcRP23 Laz BD Pharmingen San Diego CA a lin earized viral DNA of AcMNPV into Spodoptera frugiperda Sf21 cells using Lipofectin Invitrogen Life Technologies Ten recombinant baculo viruses were produced in total Baculovirus production in insect cells The IPLB Sf21 Sf21 cell line was cultured at 26 C in TC100 insect medium supplemented with 10 heat inactivated FBS It was used for the generation and propagation of wt and recombinant AcMNPV All viral stocks were prepared according to the standard protocols described by O Reilly et al 18 The virus titers were determined by quantitative PCR 18 19 Viral DNA analysis Recombinant baculoviruses were amplified at a multiplicity of infection MOI of 0 1 for 4 days in Sf21 cells before harvesting The medium Table I PCR primers used for recombinant baculovirus construction Primer Name Sequence SftI site underlined GPSF 5H11032 AGGCCTCAATGCTACTAGTAAATC 3H11032 GPSR2 5H11032 GGCCGCAAAGGCCGAATGCGCCGC 3H11032 GPNT22R 5H11032 GGCCGCAAAGGCCACGCCGTCTCGATGAAGCAC 3H11032 GPCF227 5H11032 GGCCACGGTGGCCATGATTCTCAAACAAAAGTC 3H11032 GPCR 5H11032 CCCGGGTTAATATTGTCTATTACG 3H11032 SpikeF2 5H11032 GGCCTTTGCGGCCGACCGGTGCACCACTTTTG 3H11032 Spikef489 5H11032 GGCCTTTGCGGCCATTGGCTACCAACCTTAC 3H11032 SpikeR280 5H11032 GGCCACCGTGGCCTGAGAACAATCAACAGCATC 3H11032 SpikeR324 5H11032 GGCCACCGTGGCCGGACACAAGTTTGTAATATTAGG 3H11032 SpikeR488 5H11032 GGCCACCGTGGCCCCAGTAGTGGTGTAAAAACC 3H11032 SpikeR534 5H11032 GGCCACCGTGGCCCCAGTGAGTCCATTAAAATTAAAATTGAC 3H11032 SpikeR609 5H11032 GGCCACCGTGGCCGTAGAAACATCAGTGCAG 3H11032 SpikeR688 5H11032 GGCCACCGTGGCCATTGAACTATCAGCACCTAAAG 3H11032 SpikeR763 5H11032 GGCCACCGTGGCCACTTCACGTGTGTTGCGATC 3H11032 SpikeR966 5H11032 GGCCACCGTGGCCAGTCGCGAAAGGATGTCATTTAGCAC 3H11032 7603The Journal of Immunology at Georgian Court Univ on March 4 2015 http www jimmunol org Downloaded from containing the viruses was centrifuged first at 800 rpm for 5 min to get rid of cellular debris Viral DNA was then extracted from the supernatant using the High Pure Viral Nucleic Acid kit Roche Basel Switzerland PCR primer pairs SpikeF2 and GPCR for deletion clones or SpikeF489 and GPCR for insertion clones were used to amplify the fusion protein gene fragments Western blot analysis Total proteins from Sf21 cells infected with the recombinant baculoviruses with an MOI of 5 were harvested 4 days postinfection and separated on 8 SDS PAGE The proteins were transferred onto polyvinylidene difluoride membrane Millipore Bedford MA and probed with either rabbit anti Spike Ab at 1 2000 dilutions or rabbit anti GP64 Ab 1 5000 dilution The membranes were then probed with goat anti rabbit IgG HRP Nova gen secondary Ab at 1 3000 dilutions For mammalian cells after the recombinant virus transduction cells were rapidly washed with PBS to remove medium and then lysed with the ice cold lysis buffer as described previously 17 The proteins were trans ferred to the nitrocellulose paper and the Western blot was performed 20 Control experiments consisted of the cells transduced by the control vAtE virus The immunoreactive proteins were detected using ECL Mammalian cell culture and virus transduction experiments The human lung epithelial and fibroblast cell lines A549 NCI H520 HFL 1 and MRC 5 were obtained from the American Type Culture Col lection Manassas VA and cultured in F12K RPMI 1640 F12K and DMEM respectively All of the medium was supplemented with 10 FCS 100 U ml penicillin and 100 H9262g ml streptomycin The cells were seeded into six well plate with the number of 10 5 overnight In the next day cells were incubated with the recombinant baculovirus for 2 h and then the virus mixture was removed and replaced with fresh cell culture medium Cells were then further incubated for 24 h posttransduction and the medium was collected to analyze the release of IL 8 IL 8 ELISA Quantification of IL 8 was used kit from Amersham Biosciences and per formed according to the manufacturer s recommendation RT PCR Total RNA was isolated from the cells using TRIzol reagent Invitrogen Life Technologies The reverse transcription reaction was performed using 2 H9262g of total RNA which was transcribed into cDNA using the oligo dT primer and then the cDNA was amplified for 30 cycles using two oligonu cleotide primers derived from a published IL 8 sequence 5H11032 ATGACTTC CAAGCTGGCCGTGGCT 3H11032 and 5H11032 TCTCAGCCCTCTTCAAAAACT TCT 3H11032 c fos sequence 5H11032 GAATAACATGGCTGTGCAGCCAAATGCC GCAA 3H11032 and 5H11032 CGTCAGATCAAGGGAAGCCACAGACATCT and H9252 actin sequence 5H11032 TGACGGGGTCACCCACACTGTGCCCATCTA 3H11032 and 5H11032 CTAGAAGCATTTGCGGGGACGATGGAGGG 3H11032 For IL 8 and c fos a PCR cycle consisted of a denaturation step 94 o C 1 min an annealing step 60 C for IL 8 58 C for c fos 1 min and an elongation step 72 C 1 5 min There was a total of 35 cycles followed by an additional extension step 72 C 7 min For H9252 actin PCR cycle was conducted for 30 s at 94 C 30 s at 65 C and 1 min at 70 C The PCR products were subjected to electro phoresis on a 1 5 agarose gel Quantitative data were obtained using a computing densitometer and ImageQuant software Molecular Dynamics Sunnyvale CA Preparation of nuclear extracts and the EMSA After the recombinant virus infection and transduction for the indicated time cells were washed with PBS for several times and nuclear extracts were prepared as described previously 17 Oligonucleotides correspond ing to the consensus sequences of AP 1 site on the human IL 8 promoter 5H11032 AGAAACAGTCATTTC 3H11032 were synthesized annealed and end la beled with H9253 32 P ATP using T4 polynucleotide kinase and EMSA was performed 17 When supershift assays were performed polyclonal Ab specific for anti c fos or anti p65 was added to the nuclear extracts 30 min before the binding reaction and the DNA nuclear protein complexes were separated on a 4 5 polyacrylamide gel Statistical analysis Data were analyzed using Student s t test Values of p H11021 0 05 were con sidered significant Results SARS CoV S protein up regulated IL 8 promoter and induced activation of AP 1 but not NF H9260B in the lung cells Effects of transient transfections of the SARS CoV structure pro tein encoding pcDNA3 1 S on the IL 8 promoter of the lung cells were examined The human wt IL 8 promoter luciferase construct that contains the IL 8 promoter H11002162 H1100144 was used to measure the promoter activity Overexpressions of SARS CoV structure protein S M E or N encoding plasmid induced different degrees of increase in the promoter activity data not shown SARS CoV S protein activated IL 8 promoter of all lung cells Fig 1A Its effect on the activities of the transcription factors AP 1 and NF H9260B was also studied and showed the activation of AP 1 Fig 1B but not NF H9260B Fig 1C To identify which cis acting element was involved in the S protein induced IL 8 promoter activity the IL 8 promoter luc constructs including H11002162 H1100144 wt AP 1 site H11002126 H11002120 mutant IL 8H9004AP 1 and H9260B site H1100282 H1100270 mu tant IL 8H9004H9260B were used Our results revealed that the induction of IL 8 promoter activity was